Class SimilarityTool

SimilarityTool

Nette\Object

Extended by

BaseModule\Services\BaseService

Extended by

DispatchModule\Tools\BaseTool

Extended by

DispatchModule\Tools\SimilarityTool implements DispatchModule\Tools\ToolInterface

Namespace: DispatchModule\Tools
Located at DispatchModule/searchTools/SimilarityTool.php

Methods summary
`public boolean`	# `used( )` Tells whether any sequence is set Tells whether any sequence is set Returns boolean Overrides `DispatchModule\Tools\BaseTool::used()` Implementation of `DispatchModule\Tools\ToolInterface::used()`
`public`	# `__construct( Nette\DI\Container $container )` Constructor used to save container Constructor used to save container Parameters `$container` Overrides `BaseModule\Services\BaseService::__construct()`
`public boolean`	# `addCriteria( string $name, mixed $value )` Adds search criteria Adds search criteria Parameters `$name` `$value` Returns boolean Implementation of `DispatchModule\Tools\ToolInterface::addCriteria()`
`public ResultSet`	# `execute( )` Executes query Executes query Returns ResultSet Implementation of `DispatchModule\Tools\ToolInterface::execute()`
`public string`	# `getLabel( )` Gets human-readable short description (name) of the tool Gets human-readable short description (name) of the tool Returns string human-readable short description of the tools Implementation of `DispatchModule\Tools\ToolInterface::getLabel()`

Methods inherited from DispatchModule\Tools\BaseTool
`getName(), getWantedParameters(), requireParameter()`

Properties summary
`protected DispatchModule\Models\BlastXMLParser`	`$xmlParser` XML Parser XML Parser	#
`protected BaseModule\Models\FileModel`	`$query` Representing query given to the blast tool Representing query given to the blast tool	#
`protected string`	`$directory` Directory for temporary files Directory for temporary files	#
`public string`	`$description` Short description of the tool Short description of the tool	# `'Basic Local Alignment Search Tool compares primary biological sequence information'`
`public string`	`$blastTempFile` Saves parsed blast data Saves parsed blast data	#
`protected boolean`	`$used` Flag whether any sequence is set Flag whether any sequence is set	# `false`
`protected array`	`$wantedParameters` Array of wanted parameters Array of wanted parameters	# array( 'min_coverage' => array('select', 'Min coverage', array("items" => array( '40' => '40%', '65' => '65%', '80' => '80%', '85' => '85%', '90' => '90%', '93' => '93%', '95' => '95%', '97' => '97%', '98' => '98%', '99' => '99%', '100' => '100%', ))), 'min_identity' => array('select', 'Min identity', array("items" => array( '40' => '40%', '65' => '65%', '80' => '80%', '85' => '85%', '90' => '90%', '93' => '93%', '95' => '95%', '97' => '97%', '98' => '98%', '99' => '99%', '100' => '100%', ))), 'sequence' => array('textarea', 'Sequence', array( 'placeholder' => 'AGUUCGGCACCACGGUGCAA', 'multiplicators' => array('or' => 10))), 'fasta_file' => array('file', 'Fasta file'), 'fasta_file_hidden' => array('hidden') )

Properties inherited from DispatchModule\Tools\BaseTool
`$completeData, $fileName`

Properties inherited from BaseModule\Services\BaseService
`$container`